# Transcription Atlas Our priority is transcription factor binding sites in the DNA that regulates the oxytocin receptor gene, OXTR. ## Understanding Binding Sites and our approach A transcription factor is a protein that recognises particular DNA sequences and helps regulate gene activity. A binding site is a short stretch of DNA where that recognition takes place. ![Three teaching panels: a transcription factor recognises a short DNA sequence; four illustrative sites A to D show order, spacing and motif orientation; the Atlas Beta path follows 4, 8, 7, 5, 1, 2 around M9. The open question asks whether relationships between measured binding sites have a useful correspondence with Atlas geometry.](https://universalmind.tv/informatics/science-assets/oxtr-binding-sites-atlas-beta-v1.png) The DNA sites are illustrative. The arrows on them indicate motif orientation along DNA. The Beta diagram presents the Atlas pattern beside the biological idea; the mapping is the research step ahead. The 15 sites, ENCODE clusters and predicted matches The 15 sites One OXTR promoter study reported 15 candidate binding locations using sequence analysis and laboratory binding tests. This is one study’s set, not a total for every region and cell type. An ENCODE cluster An experimental neighbourhood where a protein was detected associating with DNA. It usually covers a wider region than the exact binding sequence. The underlying experiments and cell types are linked in the catalogue. A predicted match A computer finds a DNA sequence resembling a protein’s preferred binding pattern. It is a candidate location to investigate; matching the pattern alone does not demonstrate binding in a cell. Several predictions and experimental regions can overlap the same piece of DNA. These are complementary types of evidence, so their counts remain separate. [The 15-site study](https://pubmed.ncbi.nlm.nih.gov/16569740/) · [ENCODE methods](https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg38&g=encRegTfbsClustered) · [JASPAR documentation](https://jaspar.elixir.no/docs/) THREE VIEWS OF THE SAME DATA Original DNA line → Full-position circle → Modulus 9 circle The interactive experiment can show how the same positions appear in each view, making the preserved relationships and the effects of compression visible. ## How binding sites help make the OXTR receptor Several regulatory sites can influence the same gene. Their use depends on the proteins present and the cell’s conditions; there is no single required number of sites or universal binding order. Multiple inputs. Proteins at different DNA sites help regulate the same gene. Repeated copying. One binding event does not automatically mean one RNA copy. Two kinds of binding. Transcription factors bind DNA. Oxytocin binds the receptor protein. ![Four panels show regulatory proteins at several DNA binding sites, RNA polymerase copying the OXTR gene, a ribosome producing the receptor protein, and oxytocin activating the receptor at the cell membrane. DNA positions do not establish the order in which proteins bind.](https://universalmind.tv/informatics/science-assets/oxtr-transcription-v1.png) This is a general teaching model. The illustrated sites, timing and RNA bursts are not measured OXTR data. Folding and transport are simplified. [OXTR promoter research](https://pubmed.ncbi.nlm.nih.gov/16569740/) · [Binding and RNA bursts: a yeast study](https://pubmed.ncbi.nlm.nih.gov/31101674/) · [Oxytocin–receptor structure](https://www.nature.com/articles/s41594-022-00728-4) COMPARE POSITIONS · OXTR ### Binding-site geometry Explore whether the four M9 P24 geometries help predict OXTR binding-site locations. Compare DNA observations with the original Atlas geometry side by side. Blend adds the selected geometry to the DNA panel. ##### Evidence selected ##### What the graph plots Same 39,248-base window for every source · OXTR gene + 10,000 bases on each side Inspect the observations Mapping & verification Fixed human OXTR window: GRCh38 chr3:8,740,380–8,779,628 (0-based, end-exclusive). The direction follows OXTR’s minus strand, from high to low genomic coordinates. The origin is the window edge, not the transcription start site. The line and full circle retain interval widths. For M9, one central base represents each interval within this window. An even-width interval uses the first central base in the OXTR direction. Regions extending beyond the window are clipped for display; their original coordinates remain in every export. d = floor((offset_start + offset_end − 1) / 2) Full circle = d / 39,248 turns · M9 = d mod 9 Zero is displayed as 9. All circles start at north and run clockwise. Compression merges positions; node counts expose those overlaps. The Atlas reference keeps its original grid and phase: Alpha, Gamma and Epsilon use 24 period positions; Beta uses nine residue positions. The shared circle aligns both layers at north, clockwise, with no fitted rotation. On the full-position circle, one DNA window fills one turn. On the line, Atlas turn × window length gives the guide position; only node positions are shown, without connecting curves. In M9, the DNA has nine residue positions while each Atlas guide retains its native grid. A shared angle does not equate a period index with a residue. The Atlas paths show geometry, not measured movement or binding order. The browser filters and draws precomputed results. Python/Biopython and Wolfram are used in the reproducible preparation and verification, rather than called as live services for each selection. Initial visual experiment · statistical association has not yet been tested. No negative binding controls have been curated for this map; an unrecorded position is not a failed binding test. ### Where the data comes from Three sources, with different kinds of evidence. Their counts describe different things. Findings from papers #### Published studies Individual research papers investigating how the OXTR gene is regulated. DNA elements + human brain occupancy 128study observations Two sequence-mapped elements and 126 screened BrainTF occupancy records. All 128 are available in the interactive comparison and data browser. The enhancer study adds functional reporter evidence. Laboratory measurements #### ENCODE A research project and public database of experiments that map how genes are controlled. Experiments in cells → DNA regions 255experimental DNA regions A region is a stretch of DNA with protein-binding evidence. It can contain several sites; its centre is not a confirmed binding site. Computer predictions #### JASPAR A library of DNA-binding patterns learned from experiments. Computers search DNA for matches to these patterns. Binding patterns + DNA search → matches 9,164predicted sequence matches A match is a candidate binding location. The prediction alone does not establish that a protein bound there in a cell. Studies · human brain occupancy and enhancer activity #### BrainTF · Loupe et al., 2024 126 screened ChIP-seq observations overlap our OXTR window, covering 43 protein targets and 13 brain contexts. Of these, 114 overlap the defined proximal promoter. The selection requires an author replication pass, both FRiP values at least 1%, an author NOT-HOT classification and consistent target metadata. The 1% filter is an Atlas review choice. These are regional occupancy measurements; the experiments share four donors across regions. [BrainTF publication](https://doi.org/10.1038/s41593-024-01658-8) · [Author data and analysis](https://github.com/aanderson54/Loupe_BrainTF) #### OXTR-associated enhancers · 2025 Human OCE7 DNA enhanced reporter activity in mouse hypothalamic cells and drove reporter activity in mouse olfactory bulb. This provides functional evidence; it does not identify a particular transcription factor or prove regulation of native human OXTR. The reported candidate interval and luciferase-primer span differ. Both are retained in the downloads, with no precise binding-site overlay assigned. [Enhancer publication](https://doi.org/10.1093/hmg/ddaf022) All 128 mapped observations are available in the Studies comparison below. The enhancer findings are in Literature & study evidence; they do not identify precise transcription-factor binding sites. #### Binding site A short DNA sequence recognised by a regulatory protein, called a transcription factor. #### Experimental region A stretch with evidence of protein association. The dashed centre is a plotting position, not an identified binding site. DNA sketches illustrate the distinction; they are not measured OXTR sequences or drawn to scale. ### Which evidence matters most? Start with a positive binding result at a defined DNA sequence. “Tested” alone does not tell us whether binding happened. - Binding detected at a defined sequenceA positive binding result at a specified DNA sequence is the most direct anchor for a location comparison. Check the protein, assay and biological context. - Protein association detected across a regionENCODE and BrainTF supply experimental support over a stretch of DNA. Resolve the site within it and inspect the contributing cell types and experiments. - Sequence match predictedJASPAR matches are candidates for exploration and experimental follow-up. A model match alone does not establish binding at that location. Did it change gene activity? That is a separate result, recorded alongside binding. A relevant cell type, good experimental controls and replication strengthen the evidence. A paper can report any of these evidence types. These priorities describe biological support; the significance of a geometric match needs its own statistical test. Human sites and overlap checks The human collection includes 20 records with laboratory tests and 9 with functional evidence. These categories overlap and include regional and grouped findings. US-1 and US-2 each match once in our saved OXTR reference window. Their original sequences, computed GRCh38 positions and overlap links are included in the shared data. The original 15 sites are from a human study. Their individual sequences and historical positions still need recovery from the full paper and any supplementary tables. All imports now share a common observation format. Identical reference intervals are grouped while every source observation remains available. Overlapping regions are linked; overlap alone does not establish the same binding site. The complete packages also contain the unified observations, reference intervals, source relationships and overlap tables. A total of unique confirmed human sites remains open. The interactive coordinate experiment above retains these original observations. Region, database coverage & next steps Human reference window: GRCh38 chr3:8,740,380–8,779,628, using 0-based, end-exclusive coordinates. This covers the annotated OXTR gene and 10 kb on each side. OXTR is on the minus strand. All 217,857 returned JASPAR predictions are retained in the downloads; 9,164 pass UCSC’s default score ≥400 display filter. These are motif matches, with overlapping models and positions. The filter does not establish biological activity. The downloads include reference DNA, 1,019 vertebrate motif templates, experimental provenance and 37 regional ORegAnno annotations. ENCODE clusters describe broad occupancy, including coregulators. Neither regional overlap nor motif matching alone establishes OXTR regulation. - [JASPAR 2026](https://jaspar.elixir.no/docs/) · Collected 9,164 meet UCSC’s default score >=400 display threshold. All 217,857 returned predictions are retained. Several models and strands can overlap one location. Score is a motif-match statistic, not an OXTR regulatory probability. - [ENCODE 3 / UCSC](https://www.encodeproject.org/chip-seq/transcription_factor/) · Collected 133 assayed targets across aggregated experimental contexts. Includes coregulators; not 133 confirmed OXTR-regulating TFs. Provenance joins each cluster to its experiment and cell type. - [ORegAnno / UCSC](https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg38&g=oreganno) · Collected Annotation class and factor are unresolved for most returned rows. Regional overlap alone does not establish OXTR regulation. - [TRANSFAC](https://genexplain.com/transfac-database/) · Licensed access pending Public product documentation reviewed. No licensed export or redistribution permission available; no protected entries copied. - [TFBSdb](https://tfbsdb.systemsbiology.net/viewgene/5021) · Legacy endpoint unavailable Indexed OXTR page returns HTTP 404. Search snippets are not imported as a verified database export. - [ReMap](https://remap.univ-amu.fr/download_page) · Resource identified; locus export pending No additional ReMap records counted in this release. - [ChIP-Atlas](https://chip-atlas.org/target_genes) · Resource identified; locus export pending Gene-target associations and precise binding intervals are distinct; no extra sites counted. - [Wolfram](https://reference.wolfram.com/language/ref/BioSequence.html) · Planned analysis resource A future analysis tool, not an experimental binding-site source. Broad web and bibliographic discovery plus selected primary-source review. This is a documented first collection, not a completed systematic review or a census of every OXTR regulator. Genome-wide distal elements, all cell states and all databases remain outside its scope. The experiment above presents the DNA line, full-position circle and Modulus 9 view. The coordinate calculations have been checked; a biological association with Atlas geometry has not yet been tested. Literature & study evidence · 45 catalogue records from 26 publications These 45 literature records describe findings from 26 papers. They are separate from the 128 mapped observations above: one BrainTF literature record links to all 126 of its mapped regions. Some papers report groups, functional assays or positions that remain unresolved. Filter counts refer to literature records, and evidence categories overlap. Species refers to the DNA studied: the 2025 enhancer paper uses human DNA in mouse cells and mice. Animal Oxtr findings remain available here; they are not placed on the human GRCh38 comparison. What the evidence filters mean Laboratory tested includes positive, negative and mixed results. Binding evidence includes both defined sequence elements and regional occupancy. Functional evidence describes a measured regulatory response. A record can appear in several evidence filters. Original catalogue labels remain in Methods & interpretation and the exports. Laboratory tested The record reports a laboratory assay. Includes positive, mixed and negative results; a group-level test does not resolve every member. Binding evidence Reported DNA binding or regional occupancy, at the resolution and in the system stated by the source. Functional evidence An element, region or element-based reporter has an experimental regulatory response. This does not imply every nucleotide or predicted motif was independently validated. Annotation or prediction Sequence or database annotation; direct binding is not established by the annotation alone. Regulatory context Evidence concerning gene regulation without an independently resolved binding site in this record. Scroll the table horizontally to read each source. Unknown positions remain unfilled. Source review depth is stated for each paper; trust scores for this collection are unassigned. The existing 14-study research register remains a separate collection, with shared papers cross-referenced. ## Source data - [Complete source JSON](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/oxtr-tfbs-json.zip) - [Complete source CSV](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/oxtr-tfbs-csv.zip) - [Coordinate methods](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/experiment-v1/methods.md) - [Binding evidence and priorities](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/binding-outcomes.json) - [BrainTF observations](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/study-additions-v1/braintf-peaks.csv) ## Downloads [JSON](https://universalmind.tv/informatics/atlas-guides/transcription-atlas.json?v=2026-11-01-page-narrative-4) · [CSV](https://universalmind.tv/informatics/atlas-guides/transcription-atlas.csv?v=2026-11-01-page-narrative-4) · [MD](https://universalmind.tv/informatics/atlas-guides/transcription-atlas.md?v=2026-11-01-page-narrative-4) [Interactive page](https://universalmind.tv/informatics/transcription/) · [Wiki](https://universalmind.tv/informatics/read/transcription/index.html) ## Complete guide data ```json { "catalogue": { "schema_version": "1.0", "version": "oxtr-tfbs-2026-10-19-v1", "collected_on": "2026-10-19", "title": "OXTR binding-site catalogue", "target_gene": "OXTR", "status": "Source catalogue with a reproducible exploratory coordinate experiment", "region": { "species": "Homo sapiens", "assembly": "GRCh38 / hg38", "chromosome": "chr3", "start_0based": 8740380, "end_exclusive": 8779628, "length_bp": 39248, "gene_id": "ENSG00000180914", "canonical_transcript": "ENST00000316793.8", "gene_start_1based": 8750381, "gene_end_1based": 8769628, "gene_strand": -1, "selection": "Ensembl OXTR gene body plus 10,000 bases on each genomic side", "scope": "A defined locus window; distal regulatory elements outside it are not captured. Overlapping records may extend beyond its boundaries." }, "summary": { "publications": 26, "literature_evidence_records": 45, "jaspar_all_predictions": 217857, "jaspar_default_threshold": 400, "jaspar_default_threshold_predictions": 9164, "jaspar_distinct_matrices": 1003, "jaspar_available_pfm_templates": 1019, "encode_clusters": 255, "encode_targets": 133, "oreganno_regions": 37, "unique_confirmed_oxtr_binding_site_total": null, "braintf_screened_observations": 126, "braintf_protein_targets": 43 }, "interpretation": "The original 15 sites are one human promoter study’s reported motif set. The catalogue expands the evidence base, but overlapping reports, broad regions, predictions and species are not added into one confirmed-site total.", "coordinate_convention": "Database intervals are GRCh38/hg38, 0-based start and exclusive end. Literature coordinates retain their original TSS/ATG/CpG anchors and genome builds. Unrecovered values are null; CSV blanks represent null unless the typed schema says otherwise.", "planned_views": [ "Original DNA line with biological coordinates", "Full-position circle preserving relative spacing and a fixed origin", "Modulus 9 view alongside the uncompressed positions" ], "analysis_status": "Source observations remain unchanged. experiment-v1 supplies fixed DNA-line, full-circle and M9 mappings with computational checks. No enrichment test, new motif scan or biological significance score has been applied.", "resources": [ { "name": "JASPAR 2026", "status": "Collected", "url": "https://jaspar.elixir.no/docs/", "evidence": "Published motif predictions and PFM templates", "count": 217857, "unit": "predicted motif matches", "note": "9,164 meet UCSC’s default score >=400 display threshold. All 217,857 returned predictions are retained. Several models and strands can overlap one location. Score is a motif-match statistic, not an OXTR regulatory probability." }, { "name": "ENCODE 3 / UCSC", "status": "Collected", "url": "https://www.encodeproject.org/chip-seq/transcription_factor/", "evidence": "ChIP-seq clusters, release November 2018", "count": 255, "unit": "regional occupancy clusters", "note": "133 assayed targets across aggregated experimental contexts. Includes coregulators; not 133 confirmed OXTR-regulating TFs. Provenance joins each cluster to its experiment and cell type." }, { "name": "ORegAnno / UCSC", "status": "Collected", "url": "https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg38&g=oreganno", "evidence": "Regulatory annotations, UCSC snapshot October 2015", "count": 37, "unit": "overlapping regional annotations", "note": "Annotation class and factor are unresolved for most returned rows. Regional overlap alone does not establish OXTR regulation." }, { "name": "TRANSFAC", "status": "Licensed access pending", "url": "https://genexplain.com/transfac-database/", "evidence": "Curated binding sites / regulatory knowledge", "count": null, "unit": null, "note": "Public product documentation reviewed. No licensed export or redistribution permission available; no protected entries copied." }, { "name": "TFBSdb", "status": "Legacy endpoint unavailable", "url": "https://tfbsdb.systemsbiology.net/viewgene/5021", "evidence": "Historical hg19 motif / footprint resource", "count": null, "unit": null, "note": "Indexed OXTR page returns HTTP 404. Search snippets are not imported as a verified database export." }, { "name": "ReMap", "status": "Resource identified; locus export pending", "url": "https://remap.univ-amu.fr/download_page", "evidence": "Independent ChIP-seq compendium", "count": null, "unit": null, "note": "No additional ReMap records counted in this release." }, { "name": "ChIP-Atlas", "status": "Resource identified; locus export pending", "url": "https://chip-atlas.org/target_genes", "evidence": "ChIP-seq and target-gene context", "count": null, "unit": null, "note": "Gene-target associations and precise binding intervals are distinct; no extra sites counted." }, { "name": "Wolfram", "status": "Planned analysis resource", "url": "https://reference.wolfram.com/language/ref/BioSequence.html", "evidence": "Sequence handling and symbolic analysis", "count": null, "unit": null, "note": "A future analysis tool, not an experimental binding-site source." } ], "publications": [ { "id": "TFP01", "pmid": "7798245", "title": "Structural organization of the human oxytocin receptor gene.", "authors": "Inoue T, Kimura T, Azuma C, Inazawa J, Takemura M, Kikuchi T, Kubota Y, Ogita K, Saji F.", "doi": "10.1016/s0021-9258(18)31656-9", "year": 1994, "first_publication_date": "1994-12-01", "journal": "The Journal of biological chemistry", "url": "https://pubmed.ncbi.nlm.nih.gov/7798245/", "doi_url": "https://doi.org/10.1016/s0021-9258(18)31656-9", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP02", "pmid": "16569740", "title": "Regulation of the human oxytocin receptor by nuclear factor-kappaB and CCAAT/enhancer-binding protein-beta.", "authors": "Terzidou V, Lee Y, Lindström T, Johnson M, Thornton S, Bennett PR.", "doi": "10.1210/jc.2005-2649", "year": 2006, "first_publication_date": "2006-03-28", "journal": "The Journal of clinical endocrinology and metabolism", "url": "https://pubmed.ncbi.nlm.nih.gov/16569740/", "doi_url": "https://doi.org/10.1210/jc.2005-2649", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP03", "pmid": "21734268", "title": "Synergistic regulation of human oxytocin receptor promoter by CCAAT/ enhancer-binding protein and RELA.", "authors": "Khanjani S, Terzidou V, Lee YS, Thornton S, Johnson MR, Bennett PR.", "doi": "10.1095/biolreprod.111.092304", "year": 2011, "first_publication_date": "2011-07-06", "journal": "Biology of reproduction", "url": "https://pubmed.ncbi.nlm.nih.gov/21734268/", "doi_url": "https://doi.org/10.1095/biolreprod.111.092304", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP04", "pmid": "16888077", "title": "Interleukin-1-induced NF-kappaB recruitment to the oxytocin receptor gene inhibits RNA polymerase II-promoter interactions in cultured human myometrial cells.", "authors": "Soloff MS, Izban MG, Cook DL, Jeng YJ, Mifflin RC.", "doi": "10.1093/molehr/gal067", "year": 2006, "first_publication_date": "2006-08-03", "journal": "Molecular human reproduction", "url": "https://pubmed.ncbi.nlm.nih.gov/16888077/", "doi_url": "https://doi.org/10.1093/molehr/gal067", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP05", "pmid": "15494465", "title": "Mechanical stretch up-regulates the human oxytocin receptor in primary human uterine myocytes.", "authors": "Terzidou V, Sooranna SR, Kim LU, Thornton S, Bennett PR, Johnson MR.", "doi": "10.1210/jc.2004-0277", "year": 2005, "first_publication_date": "2004-10-19", "journal": "The Journal of clinical endocrinology and metabolism", "url": "https://pubmed.ncbi.nlm.nih.gov/15494465/", "doi_url": "https://doi.org/10.1210/jc.2004-0277", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP06", "pmid": "10218980", "title": "Identification of a GABP alpha/beta binding site involved in the induction of oxytocin receptor gene expression in human breast cells, potentiation by c-Fos/c-Jun.", "authors": "Hoare S, Copland JA, Wood TG, Jeng YJ, Izban MG, Soloff MS.", "doi": "10.1210/endo.140.5.6710", "year": 1999, "first_publication_date": "1999-05-01", "journal": "Endocrinology", "url": "https://pubmed.ncbi.nlm.nih.gov/10218980/", "doi_url": "https://doi.org/10.1210/endo.140.5.6710", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP07", "pmid": "10221779", "title": "Differential protein-DNA binding analysis identifies a novel enhancer element, US-1, involved in the upregulation of the oxytocin receptor gene in human myometrium at term.", "authors": "Kimura T, Mizumoto Y, Ivell R.", "doi": "10.1016/s0303-7207(98)00225-1", "year": 1999, "first_publication_date": "1999-02-01", "journal": "Molecular and cellular endocrinology", "url": "https://pubmed.ncbi.nlm.nih.gov/10221779/", "doi_url": "https://doi.org/10.1016/s0303-7207(98)00225-1", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP08", "pmid": "10527846", "title": "Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.", "authors": "Kimura T, Ivell R, Rust W, Mizumoto Y, Ogita K, Kusui C, Matsumura Y, Azuma C, Murata Y.", "doi": "10.1006/bbrc.1999.1487", "year": 1999, "first_publication_date": "1999-10-01", "journal": "Biochemical and biophysical research communications", "url": "https://pubmed.ncbi.nlm.nih.gov/10527846/", "doi_url": "https://doi.org/10.1006/bbrc.1999.1487", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP09", "pmid": "16549056", "title": "The novel human gene MIP functions as a co-activator of hMafF.", "authors": "Ye X, Li Y, Huang Q, Yu Y, Yuan H, Wang P, Wan D, Gu J, Huo K, Li YY, Lu H.", "doi": "10.1016/j.abb.2006.02.011", "year": 2006, "first_publication_date": "2006-03-06", "journal": "Archives of biochemistry and biophysics", "url": "https://pubmed.ncbi.nlm.nih.gov/16549056/", "doi_url": "https://doi.org/10.1016/j.abb.2006.02.011", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP10", "pmid": "33633538", "title": "Maternal Diabetes-Induced Suppression of Oxytocin Receptor Contributes to Social Deficits in Offspring.", "authors": "Liu J, Liang Y, Jiang X, Xu J, Sun Y, Wang Z, Lin L, Niu Y, Song S, Zhang H, Xue Z, Lu J, Yao P.", "doi": "10.3389/fnins.2021.634781", "year": 2021, "first_publication_date": "2021-02-09", "journal": "Frontiers in neuroscience", "url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "doi_url": "https://doi.org/10.3389/fnins.2021.634781", "pmcid": "PMC7900564", "source_review": "Selected full-text methods, results and captions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP11", "pmid": "23441222", "title": "DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.", "authors": "Mamrut S, Harony H, Sood R, Shahar-Gold H, Gainer H, Shi YJ, Barki-Harrington L, Wagner S.", "doi": "10.1371/journal.pone.0056869", "year": 2013, "first_publication_date": "2013-02-18", "journal": "PloS one", "url": "https://pubmed.ncbi.nlm.nih.gov/23441222/", "doi_url": "https://doi.org/10.1371/journal.pone.0056869", "pmcid": "PMC3575498", "source_review": "Selected full-text methods, results and captions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP12", "pmid": "41109427", "title": "Interaction between time-of-day and oxytocin efficacy in mice and humans with and without gestational diabetes.", "authors": "Van-Quynh Duong T, Yaw AM, Zhou G, Sinha N, Cherukuri AS, Nguyen D, Cataldo K, Ly N, Sen A, Sempere LF, Detrie C, Seiler R, Olomu IN, Cortese R, Long R, Hoffmann HM.", "doi": "10.1016/j.molmet.2025.102269", "year": 2026, "first_publication_date": "2025-10-16", "journal": "Molecular metabolism", "url": "https://pubmed.ncbi.nlm.nih.gov/41109427/", "doi_url": "https://doi.org/10.1016/j.molmet.2025.102269", "pmcid": "PMC12902303", "source_review": "Selected full-text methods, results and captions", "existing_register_id": "E03", "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP13", "pmid": "21079000", "title": "miR-200 family and targets, ZEB1 and ZEB2, modulate uterine quiescence and contractility during pregnancy and labor.", "authors": "Renthal NE, Chen CC, Williams KC, Gerard RD, Prange-Kiel J, Mendelson CR.", "doi": "10.1073/pnas.1008301107", "year": 2010, "first_publication_date": "2010-11-15", "journal": "Proceedings of the National Academy of Sciences of the United States of America", "url": "https://pubmed.ncbi.nlm.nih.gov/21079000/", "doi_url": "https://doi.org/10.1073/pnas.1008301107", "pmcid": "PMC2996411", "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP14", "pmid": "30106994", "title": "Oxytocin receptor is regulated by Peg3.", "authors": "Frey WD, Sharma K, Cain TL, Nishimori K, Teruyama R, Kim J.", "doi": "10.1371/journal.pone.0202476", "year": 2018, "first_publication_date": "2018-08-14", "journal": "PloS one", "url": "https://pubmed.ncbi.nlm.nih.gov/30106994/", "doi_url": "https://doi.org/10.1371/journal.pone.0202476", "pmcid": "PMC6091971", "source_review": "Selected full-text methods, results and captions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP15", "pmid": "36094838", "title": "HIF-1α is essential for the augmentation of myometrial contractility during labor†.", "authors": "Wen B, Zheng Z, Wang L, Qian X, Wang X, Chen Y, Bao J, Jiang Y, Ji K, Liu H.", "doi": "10.1093/biolre/ioac174", "year": 2022, "first_publication_date": "2022-12-01", "journal": "Biology of reproduction", "url": "https://pubmed.ncbi.nlm.nih.gov/36094838/", "doi_url": "https://doi.org/10.1093/biolre/ioac174", "pmcid": "PMC9752684", "source_review": "Selected full-text methods, results and captions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP16", "pmid": "38897566", "title": "Decline in corepressor CNOT1 in the pregnant myometrium near term impairs progesterone receptor function and increases contractile gene expression", "authors": "Kwak Youn-Tae; Montalbano Alina P; Kelleher Andrew M; Colon-Caraballo Mariano; Kraus W Lee; Mahendroo Mala; Mendelson Carole R", "doi": "10.1016/j.jbc.2024.107484", "year": 2024, "first_publication_date": "2024-06-19", "journal": "Journal of Biological Chemistry", "url": "https://pubmed.ncbi.nlm.nih.gov/38897566/", "doi_url": "https://doi.org/10.1016/j.jbc.2024.107484", "pmcid": "PMC11301068", "source_review": "Selected full-text methods, results and captions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP17", "pmid": "28049625", "title": "Regulation of the macrophage oxytocin receptor in response to inflammation.", "authors": "Szeto A, Sun-Suslow N, Mendez AJ, Hernandez RI, Wagner KV, McCabe PM.", "doi": "10.1152/ajpendo.00346.2016", "year": 2017, "first_publication_date": "2017-01-03", "journal": "American journal of physiology. Endocrinology and metabolism", "url": "https://pubmed.ncbi.nlm.nih.gov/28049625/", "doi_url": "https://doi.org/10.1152/ajpendo.00346.2016", "pmcid": "PMC5374296", "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP18", "pmid": "22030357", "title": "Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.", "authors": "Thanseem I, Anitha A, Nakamura K, Suda S, Iwata K, Matsuzaki H, Ohtsubo M, Ueki T, Katayama T, Iwata Y, Suzuki K, Minoshima S, Mori N.", "doi": "10.1016/j.biopsych.2011.09.020", "year": 2012, "first_publication_date": "2011-10-26", "journal": "Biological psychiatry", "url": "https://pubmed.ncbi.nlm.nih.gov/22030357/", "doi_url": "https://doi.org/10.1016/j.biopsych.2011.09.020", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP19", "pmid": "16254027", "title": "Estrogen regulates transcription of the ovine oxytocin receptor gene through GC-rich SP1 promoter elements.", "authors": "Fleming JG, Spencer TE, Safe SH, Bazer FW.", "doi": "10.1210/en.2005-1120", "year": 2006, "first_publication_date": "2005-10-27", "journal": "Endocrinology", "url": "https://pubmed.ncbi.nlm.nih.gov/16254027/", "doi_url": "https://doi.org/10.1210/en.2005-1120", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP20", "pmid": "9048622", "title": "Cloning, novel promoter sequence, and estrogen regulation of a rat oxytocin receptor gene.", "authors": "Bale TL, Dorsa DM.", "doi": "10.1210/endo.138.3.4998", "year": 1997, "first_publication_date": "1997-03-01", "journal": "Endocrinology", "url": "https://pubmed.ncbi.nlm.nih.gov/9048622/", "doi_url": "https://doi.org/10.1210/endo.138.3.4998", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP21", "pmid": "12604656", "title": "Transcriptional regulation of the bovine oxytocin receptor gene.", "authors": "Telgmann R, Bathgate RA, Jaeger S, Tillmann G, Ivell R.", "doi": "10.1095/biolreprod.102.008961", "year": 2003, "first_publication_date": "2003-03-01", "journal": "Biology of reproduction", "url": "https://pubmed.ncbi.nlm.nih.gov/12604656/", "doi_url": "https://doi.org/10.1095/biolreprod.102.008961", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP22", "pmid": "19439725", "title": "Characterization of the cyclic adenosine monophosphate target site in the oxytocin receptor gene in rabbit amnion.", "authors": "Jeng YJ, Soloff MS.", "doi": "10.1095/biolreprod.109.077941", "year": 2009, "first_publication_date": "2009-05-13", "journal": "Biology of reproduction", "url": "https://pubmed.ncbi.nlm.nih.gov/19439725/", "doi_url": "https://doi.org/10.1095/biolreprod.109.077941", "pmcid": null, "source_review": "Abstract and bibliographic metadata", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP23", "pmid": "27108164", "title": "Oxytocin receptor DNA methylation in postpartum depression.", "authors": "Kimmel M, Clive M, Gispen F, Guintivano J, Brown T, Cox O, Beckmann MW, Kornhuber J, Fasching PA, Osborne LM, Binder E, Payne JL, Kaminsky Z.", "doi": "10.1016/j.psyneuen.2016.04.008", "year": 2016, "first_publication_date": "2016-04-08", "journal": "Psychoneuroendocrinology", "url": "https://pubmed.ncbi.nlm.nih.gov/27108164/", "doi_url": "https://doi.org/10.1016/j.psyneuen.2016.04.008", "pmcid": "PMC7152506", "source_review": "Abstract and figure descriptions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP24", "pmid": "37479681", "title": "The DNA methylation landscape of the human oxytocin receptor gene (OXTR): data-driven clusters and their relation to gene expression and childhood adversity.", "authors": "Müller S, Sicorello M, Moser D, Frach L, Limberg A, Gumpp AM, Ramo-Fernandez L, Köhler-Dauner F, Fegert JM, Waller C, Kumsta R, Kolassa IT.", "doi": "10.1038/s41398-023-02548-6", "year": 2023, "first_publication_date": "2023-07-21", "journal": "Translational psychiatry", "url": "https://pubmed.ncbi.nlm.nih.gov/37479681/", "doi_url": "https://doi.org/10.1038/s41398-023-02548-6", "pmcid": "PMC10362059", "source_review": "Selected full-text methods, results and captions", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP25", "pmid": "38831039", "title": "Multiomic profiling of transcription factor binding and function in human brain.", "authors": "Loupe JM, Anderson AG, Rizzardi LF, Rodriguez-Nunez I, Moyers B, Trausch-Lowther K, Jain R, Bunney WE, Bunney BG, Cartagena P, Sequeira A, Watson SJ, Akil H, Cooper GM, Myers RM.", "doi": "10.1038/s41593-024-01658-8", "year": 2024, "first_publication_date": "2024-06-03", "journal": "Nature neuroscience", "url": "https://pubmed.ncbi.nlm.nih.gov/38831039/", "doi_url": "https://doi.org/10.1038/s41593-024-01658-8", "pmcid": "PMC12991031", "source_review": "Public processed data, publication, supplementary tables and source metadata reviewed", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" }, { "id": "TFP26", "pmid": "39957428", "title": "Functional characterization of OXTR-associated enhancers.", "authors": "Laboy Cintrón D, Sheng RR, Ahituv N.", "doi": "10.1093/hmg/ddaf022", "year": 2025, "first_publication_date": "2025-05-01", "journal": "Human molecular genetics", "url": "https://pubmed.ncbi.nlm.nih.gov/39957428/", "doi_url": "https://doi.org/10.1093/hmg/ddaf022", "pmcid": "PMC12056307", "source_review": "Public processed data, publication, supplementary tables and source metadata reviewed", "existing_register_id": null, "trust_score": null, "trust_status": "Not assigned; evidence type and review depth reported", "jadad": "Not applicable: not a randomized clinical trial" } ], "evidence": [ { "id": "TFBS001", "pmid": "7798245", "species": "Homo sapiens", "factor": "SP1; AP1; AP2; GATA1; MYB; NFIL6; APRE", "label": "Historical promoter annotation", "evidence_kind": "reported_motif_group", "methods": "Gene sequencing / motif annotation", "finding": "The original gene report annotates several regulatory motifs.", "reported_position": "SP1 approximately 65 bp upstream of the reported TSS; two TSSs reported", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Legacy numbering and multiple TSSs need reconciliation. These annotations are not individual experimentally validated sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/7798245/", "publication_id": "TFP01", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681b49f47d974017343d8", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS002", "pmid": "7798245", "species": "Homo sapiens", "factor": "Estrogen receptor family", "label": "ERE half-sites", "evidence_kind": "reported_motif_group", "methods": "Gene sequencing / motif annotation", "finding": "Three half-palindromic EREs were reported.", "reported_position": null, "reported_sequence": null, "reported_count": 3, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "The report did not identify a classical complete ERE. Later ERE-like annotations use different regions and methods.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/7798245/", "publication_id": "TFP01", "notion_url": "https://app.notion.com/p/3fd7b9c99c568131a5e2facac9dc49ae", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS003", "pmid": "16569740", "species": "Homo sapiens", "factor": "AP1", "label": "The original 15-site report", "evidence_kind": "reported_motif_group", "methods": "Computer analysis and EMSA; promoter assays", "finding": "3 AP1 sites form part of the paper’s reported set of 15.", "reported_position": null, "reported_sequence": null, "reported_count": 3, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Individual site sequences and coordinates were not recovered. The abstract does not establish the same functional contribution for every site; these groups cannot yet be deduplicated against later papers.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/16569740/", "publication_id": "TFP02", "notion_url": "https://app.notion.com/p/3fd7b9c99c56817ab807c2510a9e6524", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS004", "pmid": "16569740", "species": "Homo sapiens", "factor": "C/EBP", "label": "The original 15-site report", "evidence_kind": "reported_motif_group", "methods": "Computer analysis and EMSA; promoter assays", "finding": "9 C/EBP sites form part of the paper’s reported set of 15.", "reported_position": null, "reported_sequence": null, "reported_count": 9, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Individual site sequences and coordinates were not recovered. The abstract does not establish the same functional contribution for every site; these groups cannot yet be deduplicated against later papers.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/16569740/", "publication_id": "TFP02", "notion_url": "https://app.notion.com/p/3fd7b9c99c568119a03cd362dec7db0b", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS005", "pmid": "16569740", "species": "Homo sapiens", "factor": "NF-kappaB", "label": "The original 15-site report", "evidence_kind": "reported_motif_group", "methods": "Computer analysis and EMSA; promoter assays", "finding": "3 NF-kappaB sites form part of the paper’s reported set of 15.", "reported_position": null, "reported_sequence": null, "reported_count": 3, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Individual site sequences and coordinates were not recovered. The abstract does not establish the same functional contribution for every site; these groups cannot yet be deduplicated against later papers.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/16569740/", "publication_id": "TFP02", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681c19537c556503d98e8", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS006", "pmid": "16569740", "species": "Homo sapiens", "factor": "C/EBPbeta; NF-kappaB", "label": "Synergistic response region", "evidence_kind": "functional_region", "methods": "Deletion / reporter assays", "finding": "A promoter region participates in the combined response.", "reported_position": "−851 to −656 relative to the paper’s promoter origin", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Overlaps the more focused region investigated in PMID 21734268; do not count the two studies as independent sites.", "related_evidence": "21734268", "source_url": "https://pubmed.ncbi.nlm.nih.gov/16569740/", "publication_id": "TFP02", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681e8ab17d34f84d266b9", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS007", "pmid": "21734268", "species": "Homo sapiens", "factor": "CEBPB; RELA", "label": "Shared 20-base region", "evidence_kind": "functional_region", "methods": "Deletion / DNA-binding / reporter assays", "finding": "A 20-base region is required for synergy and binds both factors.", "reported_position": "−712 to −692 in the paper’s promoter numbering", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "One shared region, not two independent sites. Historical endpoint convention retained; no genomic conversion applied.", "related_evidence": "16569740", "source_url": "https://pubmed.ncbi.nlm.nih.gov/21734268/", "publication_id": "TFP03", "notion_url": "https://app.notion.com/p/3fd7b9c99c56815eb710c0033d28dd3a", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS008", "pmid": "16888077", "species": "Homo sapiens", "factor": "NF-kappaB", "label": "IL-1 recruitment region", "evidence_kind": "occupancy_region", "methods": "ChIP / RNA polymerase II assays", "finding": "IL-1 recruits NF-kappaB while reducing promoter-associated RNA polymerase II.", "reported_position": "Approximately −955 from TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "A reported position is not a motif extent. Regulatory direction depends on cellular and stimulus context.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/16888077/", "publication_id": "TFP04", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681ff9aafddfbac927dd8", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS009", "pmid": "15494465", "species": "Homo sapiens", "factor": "C/EBP; AP1", "label": "Mechanical stretch response", "evidence_kind": "regulatory_context", "methods": "Primary myocytes / EMSA / reporter assays", "finding": "Stretch increases factor binding; C/EBP overexpression activates the tested OXTR promoter.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Regulatory context; no additional individually mapped site is counted.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/15494465/", "publication_id": "TFP05", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681f4a9def727db9c5a6a", "evidence_categories": [ "laboratory_tested", "regulatory_context" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS010", "pmid": "10218980", "species": "Homo sapiens", "factor": "GABPA; GABPB", "label": "GABP element", "evidence_kind": "functional_region", "methods": "EMSA / immunoshift / mutation / reporter assays", "finding": "A GABP element supports OXTR promoter activation in Hs578T breast cells.", "reported_position": "−85 to −65 from TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Reported regulatory interval contains more than one element. GABP alpha/beta names are unrelated to Atlas sequence labels.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/10218980/", "publication_id": "TFP06", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681e2b619d33faa860bca", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS011", "pmid": "10218980", "species": "Homo sapiens", "factor": "CRE/AP1-like element", "label": "Adjacent cooperating element", "evidence_kind": "functional_region", "methods": "Mutation / reporter assays", "finding": "Mutation of the CRE/AP1-like element also removes promoter activation.", "reported_position": "Within −85 to −65 from TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Exact motif endpoints and the binding factor at this element remain unresolved in the material reviewed.", "related_evidence": "TFBS010", "source_url": "https://pubmed.ncbi.nlm.nih.gov/10218980/", "publication_id": "TFP06", "notion_url": "https://app.notion.com/p/3fd7b9c99c568106ad70e80f2f5089a7", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS012", "pmid": "10221779", "species": "Homo sapiens", "factor": "Unresolved", "label": "US-1 enhancer", "evidence_kind": "sequence_supported", "methods": "Differential EMSA / enhancer reporter", "finding": "A sequence supports differential protein binding and enhancer activity.", "reported_position": "Within a reported 20-base region", "reported_sequence": "TCTGCCTTCATCCAGCC", "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "The reported sequence has 17 bases; retain it separately from the 20-base region description. Factor identity and genomic mapping remain open.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/10221779/", "publication_id": "TFP07", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681c199cbf4aa8196bca5", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": "GRCh38", "chromosome": "chr3", "start_0based": 8770729, "end_exclusive": 8770746, "strand": "-", "mapping_status": "Exact published-sequence match; unique within saved window", "reference_interval_id": "OXI_32104d8247675a84" } }, { "id": "TFBS013", "pmid": "10527846", "species": "Homo sapiens", "factor": "MAFF", "label": "US-2 element", "evidence_kind": "sequence_supported", "methods": "Yeast one-hybrid / EMSA", "finding": "Human MafF binds the reported US-2 sequence.", "reported_position": null, "reported_sequence": "GGAATGATTACTCAGCTAGA", "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Sequence retained as reported; genomic placement has not been independently aligned.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/10527846/", "publication_id": "TFP08", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681ad8e9dcefd9bb0cbb5", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": "GRCh38", "chromosome": "chr3", "start_0based": 8770405, "end_exclusive": 8770425, "strand": "-", "mapping_status": "Exact published-sequence match; unique within saved window", "reference_interval_id": "OXI_f3fca88c24a0eb18" } }, { "id": "TFBS014", "pmid": "16549056", "species": "Homo sapiens", "factor": "MAFF; MIP", "label": "US-2 co-activation", "evidence_kind": "regulatory_context", "methods": "Tandem-element reporter / co-expression", "finding": "MIP supports MafF-mediated activation in the US-2 reporter system.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Reuses US-2; not an additional binding site. MIP is a co-activator.", "related_evidence": "TFBS013", "source_url": "https://pubmed.ncbi.nlm.nih.gov/16549056/", "publication_id": "TFP09", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681cb9e29e34d5ce0e462", "evidence_categories": [ "laboratory_tested", "functional_evidence", "regulatory_context" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS015", "pmid": "33633538", "species": "Homo sapiens", "factor": "ESR2 / ERbeta", "label": "ERE-like element", "evidence_kind": "functional_region", "methods": "Promoter mutation / reporter / ChIP", "finding": "ERE-like elements participate in the reported OXTR response.", "reported_position": "-1005 from TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": "ENST00000316793.7", "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Position labels, not recovered motif extents. ChIP supports regional occupancy; it does not resolve each motif separately.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "publication_id": "TFP10", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681b6ac3dc6225d284e26", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS016", "pmid": "33633538", "species": "Homo sapiens", "factor": "ESR2 / ERbeta", "label": "ERE-like element", "evidence_kind": "functional_region", "methods": "Promoter mutation / reporter / ChIP", "finding": "ERE-like elements participate in the reported OXTR response.", "reported_position": "-944 from TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": "ENST00000316793.7", "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Position labels, not recovered motif extents. ChIP supports regional occupancy; it does not resolve each motif separately.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "publication_id": "TFP10", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681199acaf40df69f5c6d", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS017", "pmid": "33633538", "species": "Homo sapiens", "factor": "GATA1", "label": "Other motifs in the assayed region", "evidence_kind": "reported_motif_group", "methods": "Motif annotation / regional ChIP", "finding": "Candidate motif annotations in the −1100 to −900 interval.", "reported_position": "−1100 to −900 from TSS", "reported_sequence": null, "reported_count": 1, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Prediction is not proof of individual occupancy or regulatory function. The two ERE-like elements are recorded separately.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "publication_id": "TFP10", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681efb518ca5375ec81f5", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS018", "pmid": "33633538", "species": "Homo sapiens", "factor": "SP1", "label": "Other motifs in the assayed region", "evidence_kind": "reported_motif_group", "methods": "Motif annotation / regional ChIP", "finding": "Candidate motif annotations in the −1100 to −900 interval.", "reported_position": "−1100 to −900 from TSS", "reported_sequence": null, "reported_count": 1, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Prediction is not proof of individual occupancy or regulatory function. The two ERE-like elements are recorded separately.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "publication_id": "TFP10", "notion_url": "https://app.notion.com/p/3fd7b9c99c568120a50bc9ea5d7be6b7", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS019", "pmid": "33633538", "species": "Homo sapiens", "factor": "YY1", "label": "Other motifs in the assayed region", "evidence_kind": "reported_motif_group", "methods": "Motif annotation / regional ChIP", "finding": "Candidate motif annotations in the −1100 to −900 interval.", "reported_position": "−1100 to −900 from TSS", "reported_sequence": null, "reported_count": 1, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Prediction is not proof of individual occupancy or regulatory function. The two ERE-like elements are recorded separately.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "publication_id": "TFP10", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681aab7f7e1d0b35a2088", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS020", "pmid": "33633538", "species": "Homo sapiens", "factor": "CEBPA", "label": "Other motifs in the assayed region", "evidence_kind": "reported_motif_group", "methods": "Motif annotation / regional ChIP", "finding": "Candidate motif annotations in the −1100 to −900 interval.", "reported_position": "−1100 to −900 from TSS", "reported_sequence": null, "reported_count": 2, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Prediction is not proof of individual occupancy or regulatory function. The two ERE-like elements are recorded separately.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/33633538/", "publication_id": "TFP10", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681d58339e65bd58fdced", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS021", "pmid": "23441222", "species": "Mus musculus", "factor": "Half ERE", "label": "CpG-associated candidate element", "evidence_kind": "candidate_region", "methods": "Methylation / promoter mutation / reporter assays", "finding": "The study tests methylation-sensitive Oxtr promoter regulation.", "reported_position": "CpG position -932; not the motif start", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Coordinates label CpGs inside candidate elements. Direct occupancy by the named factor was not established by these assays.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/23441222/", "publication_id": "TFP11", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681228a52ec1bd80e4eab", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS022", "pmid": "23441222", "species": "Mus musculus", "factor": "Putative SP1", "label": "CpG-associated candidate element", "evidence_kind": "candidate_region", "methods": "Methylation / promoter mutation / reporter assays", "finding": "The study tests methylation-sensitive Oxtr promoter regulation.", "reported_position": "CpG position -733; not the motif start", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Coordinates label CpGs inside candidate elements. Direct occupancy by the named factor was not established by these assays.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/23441222/", "publication_id": "TFP11", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681ea93e0faa2747eb315", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS023", "pmid": "41109427", "species": "Mus musculus", "factor": "BMAL1 / clock complex", "label": "E1 E′-box", "evidence_kind": "tested_candidate", "methods": "NIH3T3 promoter mutation / reporter assays", "finding": "Mutation does not abolish the tested BMAL1-induced reporter response.", "reported_position": "Within −1000 to +200 of mouse Oxtr promoter", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "The four candidate sites belong to the mouse promoter. Published occupancy context includes male mouse liver; these are not four confirmed human or uterine ChIP sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/41109427/", "publication_id": "TFP12", "notion_url": "https://app.notion.com/p/3fd7b9c99c56811391b5d7dfedc5b5b9", "evidence_categories": [ "laboratory_tested" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS024", "pmid": "41109427", "species": "Mus musculus", "factor": "BMAL1 / clock complex", "label": "E2 E′-box", "evidence_kind": "functional_candidate", "methods": "NIH3T3 promoter mutation / reporter assays", "finding": "Mutation abolishes the tested BMAL1-induced reporter response.", "reported_position": "Within −1000 to +200 of mouse Oxtr promoter", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "The four candidate sites belong to the mouse promoter. Published occupancy context includes male mouse liver; these are not four confirmed human or uterine ChIP sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/41109427/", "publication_id": "TFP12", "notion_url": "https://app.notion.com/p/3fd7b9c99c56812981c6c238df1d15b8", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS025", "pmid": "41109427", "species": "Mus musculus", "factor": "BMAL1 / clock complex", "label": "E3 E′-box", "evidence_kind": "tested_candidate", "methods": "NIH3T3 promoter mutation / reporter assays", "finding": "Mutation does not abolish the tested BMAL1-induced reporter response.", "reported_position": "Within −1000 to +200 of mouse Oxtr promoter", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "The four candidate sites belong to the mouse promoter. Published occupancy context includes male mouse liver; these are not four confirmed human or uterine ChIP sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/41109427/", "publication_id": "TFP12", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681e5af2bfbb87f79f744", "evidence_categories": [ "laboratory_tested" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS026", "pmid": "41109427", "species": "Mus musculus", "factor": "BMAL1 / clock complex", "label": "E4 E′-box", "evidence_kind": "functional_candidate", "methods": "NIH3T3 promoter mutation / reporter assays", "finding": "Mutation abolishes the tested BMAL1-induced reporter response.", "reported_position": "Within −1000 to +200 of mouse Oxtr promoter", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "The four candidate sites belong to the mouse promoter. Published occupancy context includes male mouse liver; these are not four confirmed human or uterine ChIP sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/41109427/", "publication_id": "TFP12", "notion_url": "https://app.notion.com/p/3fd7b9c99c56813cb679d1bfbebbb46f", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS027", "pmid": "21079000", "species": "Homo sapiens", "factor": "ZEB1; ZEB2", "label": "Myometrial repression", "evidence_kind": "regulatory_context", "methods": "Overexpression / expression assays", "finding": "ZEB1 and ZEB2 overexpression represses OXTR in human myometrial cells.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Abstract-level review; no human motif-level genomic interval recovered. Animal experiments in the same paper are not merged into this record.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/21079000/", "publication_id": "TFP13", "notion_url": "https://app.notion.com/p/3fd7b9c99c56815fb773ead3e9ca8100", "evidence_categories": [ "laboratory_tested", "regulatory_context" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS028", "pmid": "30106994", "species": "Mus musculus", "factor": "PEG3", "label": "BS1", "evidence_kind": "binding_supported", "methods": "Competitive EMSA", "finding": "Competitive EMSA supports binding.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Site sequences require figure-level recovery. The paper describes a 225-bp ChIP region but also lists mm10 chr6:112488870–112489904, an inconsistent span; genomic normalization is withheld.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/30106994/", "publication_id": "TFP14", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681f6afe9d86a91f2f189", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS029", "pmid": "30106994", "species": "Mus musculus", "factor": "PEG3", "label": "BS2", "evidence_kind": "tested_candidate", "methods": "Competitive EMSA", "finding": "The reported competitive EMSA did not support binding.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Site sequences require figure-level recovery. The paper describes a 225-bp ChIP region but also lists mm10 chr6:112488870–112489904, an inconsistent span; genomic normalization is withheld.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/30106994/", "publication_id": "TFP14", "notion_url": "https://app.notion.com/p/3fd7b9c99c56818bb8adedd03a749745", "evidence_categories": [ "laboratory_tested" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS030", "pmid": "30106994", "species": "Mus musculus", "factor": "PEG3", "label": "BS3", "evidence_kind": "binding_supported", "methods": "Competitive EMSA", "finding": "Competitive EMSA supports binding.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Site sequences require figure-level recovery. The paper describes a 225-bp ChIP region but also lists mm10 chr6:112488870–112489904, an inconsistent span; genomic normalization is withheld.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/30106994/", "publication_id": "TFP14", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681edb78ac3a5d1512d44", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS031", "pmid": "30106994", "species": "Mus musculus", "factor": "PEG3", "label": "BS4", "evidence_kind": "binding_supported", "methods": "Competitive EMSA / ChIP", "finding": "Competitive EMSA supports binding. BS4 also lies in the ChIP-tested region.", "reported_position": "Third-exon region", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Site sequences require figure-level recovery. The paper describes a 225-bp ChIP region but also lists mm10 chr6:112488870–112489904, an inconsistent span; genomic normalization is withheld.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/30106994/", "publication_id": "TFP14", "notion_url": "https://app.notion.com/p/3fd7b9c99c568165be1aed7d30228f19", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS032", "pmid": "30106994", "species": "Mus musculus", "factor": "PEG3", "label": "BS5", "evidence_kind": "tested_candidate", "methods": "Competitive EMSA", "finding": "The reported competitive EMSA did not support binding.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Site sequences require figure-level recovery. The paper describes a 225-bp ChIP region but also lists mm10 chr6:112488870–112489904, an inconsistent span; genomic normalization is withheld.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/30106994/", "publication_id": "TFP14", "notion_url": "https://app.notion.com/p/3fd7b9c99c56812bbcd9c131c101c287", "evidence_categories": [ "laboratory_tested" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS033", "pmid": "36094838", "species": "Homo sapiens", "factor": "HIF1A", "label": "Hypoxia-associated coding-region occupancy", "evidence_kind": "occupancy_region", "methods": "ChIP-seq / hypoxia / knockdown", "finding": "HIF1A occupancy is reported in the OXTR coding region with expression responses to hypoxia.", "reported_position": "OXTR coding region", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "A ChIP region is not a resolved short binding motif. Exact peak coordinates were not recovered from the article.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/36094838/", "publication_id": "TFP15", "notion_url": "https://app.notion.com/p/3fd7b9c99c568190a017c40ce9a05338", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS034", "pmid": "38897566", "species": "Mus musculus", "factor": "PGR; CNOT1", "label": "Progesterone receptor complex", "evidence_kind": "regulatory_context", "methods": "Myometrial ChIP / re-ChIP", "finding": "The mouse Oxtr region shows PR binding; CNOT1 re-ChIP enrichment at Oxtr was not significant.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "CNOT1 is a coregulator, not an established sequence-specific DNA-binding factor. Human cell experiments in the paper are additional context, not merged site counts.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/38897566/", "publication_id": "TFP16", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681db86a5c8c09ea3292e", "evidence_categories": [ "laboratory_tested", "binding_evidence", "regulatory_context" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS035", "pmid": "28049625", "species": "Homo sapiens", "factor": "NF-kappaB", "label": "Inflammatory macrophage response", "evidence_kind": "regulatory_context", "methods": "Primary macrophages / THP-1 / pathway inhibition", "finding": "Inflammatory induction of OXTR depends on NF-kappaB signalling in the studied cells.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Regulatory evidence without an additional mapped binding site.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/28049625/", "publication_id": "TFP17", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681df9203f7f14645c442", "evidence_categories": [ "laboratory_tested", "regulatory_context" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS036", "pmid": "22030357", "species": "Homo sapiens", "factor": "SP1", "label": "Neural cell expression response", "evidence_kind": "regulatory_context", "methods": "Human tissue / SK-N-SH silencing / inhibitor", "finding": "SP1 perturbation changes OXTR expression in the studied neural cells.", "reported_position": null, "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Expression dependence does not locate a binding site. Other genes in the study are not OXTR sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/22030357/", "publication_id": "TFP18", "notion_url": "https://app.notion.com/p/3fd7b9c99c56818c935af366b219c79e", "evidence_categories": [ "laboratory_tested", "regulatory_context" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS037", "pmid": "16254027", "species": "Ovis aries", "factor": "SP1", "label": "GC-rich promoter element", "evidence_kind": "functional_region", "methods": "Promoter mutation / reporter assays", "finding": "SP1 elements support basal and estrogen-mediated promoter activity.", "reported_position": "-104 in the paper’s promoter numbering", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Ovine evidence; estrogen-mediated action at these elements is not a human ERE site.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/16254027/", "publication_id": "TFP19", "notion_url": "https://app.notion.com/p/3fd7b9c99c568189b484f46c5d6664a4", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS038", "pmid": "16254027", "species": "Ovis aries", "factor": "SP1", "label": "GC-rich promoter element", "evidence_kind": "functional_region", "methods": "Promoter mutation / reporter assays", "finding": "SP1 elements support basal and estrogen-mediated promoter activity.", "reported_position": "-64 in the paper’s promoter numbering", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Ovine evidence; estrogen-mediated action at these elements is not a human ERE site.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/16254027/", "publication_id": "TFP19", "notion_url": "https://app.notion.com/p/3fd7b9c99c568103940df4a52464f5e2", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS039", "pmid": "9048622", "species": "Rattus norvegicus", "factor": "Estrogen receptor", "label": "Upstream palindromic ERE", "evidence_kind": "functional_region", "methods": "EMSA / mutation / reporter assays", "finding": "An upstream ERE supports estrogen-responsive transcription.", "reported_position": "Approximately 4 kb upstream of translation start (ATG)", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Translation-start anchor, not TSS; approximate position only.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/9048622/", "publication_id": "TFP20", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681b1aa1cf38873c4fcc8", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS040", "pmid": "12604656", "species": "Bos taurus", "factor": "IRF1; IRF2", "label": "Interferon-response element", "evidence_kind": "functional_region", "methods": "EMSA / reporter assays", "finding": "An upstream element binds IRF1 and IRF2.", "reported_position": "Approximately −2400 from TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "One shared bovine element, not two independent sites.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/12604656/", "publication_id": "TFP21", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681f6afc5db5a1b749dfe", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS041", "pmid": "19439725", "species": "Oryctolagus cuniculus", "factor": "CREB", "label": "cAMP-responsive region", "evidence_kind": "occupancy_region", "methods": "DNase hypersensitivity / ChIP / reporter assays", "finding": "A CREB-associated region participates in the amnion cAMP response.", "reported_position": "A 200-bp region approximately 4.7 kb upstream of TSS", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "Broad region in rabbit amnion; exact motif endpoints were not recovered.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/19439725/", "publication_id": "TFP22", "notion_url": "https://app.notion.com/p/3fd7b9c99c568179a8baffa9646225ba", "evidence_categories": [ "laboratory_tested", "binding_evidence", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS042", "pmid": "27108164", "species": "Homo sapiens", "factor": "ESR1; SP1", "label": "Methylation-associated motif annotations", "evidence_kind": "candidate_region", "methods": "Motif prediction / published genomic tracks", "finding": "The paper relates methylation measurements to candidate regulatory motifs.", "reported_position": "hg19 CpGs chr3:8810078 and chr3:8810069", "reported_sequence": null, "reported_count": null, "genome_build": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Original report; genomic mapping unresolved", "limitation": "These coordinates are CpG anchors, not motif coordinates. No new binding-site count is inferred.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/27108164/", "publication_id": "TFP23", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681319b19c000bdacc76c", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS043", "pmid": "37479681", "species": "Homo sapiens", "factor": "EGR1", "label": "OREG1492306", "evidence_kind": "annotated_region", "methods": "Published annotation / methylation study", "finding": "The paper references an EGR1-associated ORegAnno region.", "reported_position": "GRCh38 chr3:8767502–8768543 (BED)", "reported_sequence": null, "reported_count": null, "genome_build": "GRCh38", "chromosome": "chr3", "start_0based": 8767502, "end_exclusive": 8768543, "motif_strand": null, "reference_transcript": null, "coordinate_status": "ORegAnno interval recovered; regional annotation", "limitation": "Annotation reused by the paper, not a new EGR1 binding experiment.", "related_evidence": "OREG1492306", "source_url": "https://pubmed.ncbi.nlm.nih.gov/37479681/", "publication_id": "TFP24", "notion_url": "https://app.notion.com/p/3fd7b9c99c5681ab85e3ef81162f1785", "evidence_categories": [ "annotation_prediction" ], "normalized_location": { "assembly": "GRCh38", "chromosome": "chr3", "start_0based": 8767502, "end_exclusive": 8768543, "strand": null, "mapping_status": "Source regional annotation", "reference_interval_id": "OXI_535fab762f477748" } }, { "id": "TFBS044", "pmid": "38831039", "species": "Homo sapiens", "factor": "43 assayed protein targets", "label": "BrainTF human brain occupancy", "evidence_kind": "occupancy_region", "methods": "Human postmortem brain ChIP-seq; review of author replication tests, FRiP and HOT-region annotations.", "finding": "126 screened protein-occupancy observations overlap the OXTR window, representing 43 targets across 13 contexts. 114 overlap the defined proximal promoter.", "reported_position": "Individual GRCh38 peak intervals are in study-additions-v1/braintf-peaks.json.", "reported_sequence": null, "reported_count": null, "genome_build": "GRCh38", "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Individual regional observations retained separately; no single precise binding-site coordinate assigned", "limitation": "Peak observations across assay contexts, not unique sites or independent donors. The experiments share four postmortem donors across regions. Repeated contexts do not establish population replication. Assayed targets include chromatin-associated proteins and cofactors as well as transcription factors. ChIP-seq measures regional occupancy; it does not locate a contact nucleotide.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/38831039/", "publication_id": "TFP25", "evidence_categories": [ "laboratory_tested", "binding_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } }, { "id": "TFBS045", "pmid": "39957428", "species": "Homo sapiens", "factor": "Factor not resolved", "label": "OCE7 enhancer reporter evidence", "evidence_kind": "functional_region", "methods": "Human candidate enhancer DNA in mouse hypothalamic-cell luciferase assays and mouse reporter experiments.", "finding": "OCE1, OCE5 and OCE7 enhanced reporter activity in mouse hypothalamic cells. The tested DNA was human. OCE7 also drove reporter activity in mouse olfactory bulb at P28 and P56; adult hypothalamic activity was not detected.", "reported_position": "OCE7 reported hg38 chr3:8757366–8759184; candidate interval and tested construct boundaries retained separately.", "reported_sequence": null, "reported_count": null, "genome_build": "GRCh38", "chromosome": null, "start_0based": null, "end_exclusive": null, "motif_strand": null, "reference_transcript": null, "coordinate_status": "Individual regional observations retained separately; no single precise binding-site coordinate assigned", "limitation": "Reporter activity does not establish a named transcription-factor binding site or causal regulation of native human OXTR. The reported OCE7 candidate interval and the Table 1 luciferase-primer span differ. Reported intervals and primer matches are retained separately, without a precise binding-site overlay.", "related_evidence": null, "source_url": "https://pubmed.ncbi.nlm.nih.gov/39957428/", "publication_id": "TFP26", "evidence_categories": [ "laboratory_tested", "functional_evidence" ], "normalized_location": { "assembly": null, "chromosome": null, "start_0based": null, "end_exclusive": null, "strand": null, "mapping_status": "Unresolved", "reference_interval_id": null } } ], "search_queries": [ { "file": "pubmed-oxtr.json", "url": "https://www.ebi.ac.uk/europepmc/webservices/rest/search?query=TITLE_ABS:%22oxytocin%20receptor%22%20AND%20(TITLE_ABS:promoter%20OR%20TITLE_ABS:%22transcription%20factor%22)&format=json&pageSize=1000&resultType=core", "retrieved_on": "2026-10-19", "returned": 128 }, { "file": "pubmed-oxtr-expanded.json", "url": "https://www.ebi.ac.uk/europepmc/webservices/rest/search?query=(TITLE_ABS:OXTR%20OR%20TITLE_ABS:%22oxytocin%20receptor%22)%20AND%20(TITLE_ABS:%22binding%20site%22%20OR%20TITLE_ABS:%22transcription%20factor%22%20OR%20TITLE_ABS:promoter)&format=json&pageSize=1000&resultType=core", "retrieved_on": "2026-10-19", "returned": 174 }, { "file": "tf-publications.json", "url": "https://www.ebi.ac.uk/europepmc/webservices/rest/search?query=TITLE:oxytocin%20AND%20(TITLE:Peg3%20OR%20TITLE:macrophage%20OR%20TITLE:methylation%20OR%20TITLE:%22time-of-day%22)&format=json&pageSize=1000&resultType=core", "retrieved_on": "2026-10-19", "returned": 94 }, { "file": "inoue.json", "url": "https://www.ebi.ac.uk/europepmc/webservices/rest/search?query=EXT_ID:7798245&format=json&resultType=core", "retrieved_on": "2026-10-19", "returned": 1 } ], "coverage": "Broad web and bibliographic discovery plus selected primary-source review. This is a documented first collection, not a completed systematic review or a census of every OXTR regulator. Genome-wide distal elements, all cell states and all databases remain outside its scope.", "outstanding": [ "Recover individual sequences / coordinates for the 2006 15-site paper and other legacy articles", "Resolve historical TSS numbering and the Peg3 span inconsistency before coordinate conversion", "Obtain authorized TRANSFAC access and check current ReMap / ChIP-Atlas locus data", "Deduplicate overlapping evidence and distinguish factor identity from motif-family ambiguity", "Choose tissue, regulatory window and comparison rules before any Atlas geometry test" ], "files": { "evidence": "literature-evidence.json", "publications": "publications.json", "jaspar_predictions": "jaspar-predictions.json.gz", "jaspar_templates": "jaspar-pfm-templates.json", "encode": "encode-clusters.json", "encode_provenance": "encode-provenance.json", "oreganno": "oreganno-regions.json", "reference_dna": "reference-dna.json", "sources": "sources.csv", "search_ledger": "search-ledger.json", "json_bundle": "oxtr-tfbs-json.zip", "csv_bundle": "oxtr-tfbs-csv.zip", "study_peaks": "study-additions-v1/braintf-peaks.json", "study_review": "study-additions-v1/review.json" }, "sources": [ { "file": "ensembl-oxtr.json", "url": "https://rest.ensembl.org/lookup/symbol/homo_sapiens/OXTR?expand=1;content-type=application/json", "retrieved_on": "2026-10-19", "sha256": "fab987ac5b7411dca09a2263f115c9eb699bb75513d060a46e94e5e275a30886", "bytes": 10057, "snapshot": "source-snapshots/ensembl-oxtr.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "oxtr-dna.json", "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38;chrom=chr3;start=8740380;end=8779628", "retrieved_on": "2026-10-19", "sha256": "988570c8a78fd419b2dcd62ba081473260d9500d5839f6df07040d955b774def", "bytes": 39403, "snapshot": "source-snapshots/oxtr-dna.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "ref-dna-expanded.json", "url": "https://api.genome.ucsc.edu/getData/sequence?genome=hg38;chrom=chr3;start=8730000;end=8790000", "retrieved_on": "2026-10-19", "sha256": "7394b02ddb3664b93adb468a1c75f56c41adda0de9394c30f318ae17f59fd2d2", "bytes": 60155, "snapshot": "source-snapshots/ref-dna-expanded.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "jaspar-oxtr.json", "url": "https://api.genome.ucsc.edu/getData/track?genome=hg38;track=jaspar2026;chrom=chr3;start=8740380;end=8779628;maxItemsOutput=1000000", "retrieved_on": "2026-10-19", "sha256": "f550b6a5c882c8d9efc196d9eebf2d8731707c006857bf62f5cbd8f268f9a6d3", "bytes": 28984951, "snapshot": "source-snapshots/jaspar-oxtr.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "jaspar2026-vertebrates.jaspar", "url": "https://jaspar.elixir.no/download/data/2026/CORE/JASPAR2026_CORE_vertebrates_non-redundant_pfms_jaspar.txt", "retrieved_on": "2026-10-19", "sha256": "4005b5449ba07d9b58495f51143186e7e3959efd0ad670770fbddf57bf941e8f", "bytes": 336314, "snapshot": "source-snapshots/jaspar2026-vertebrates.jaspar.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "jaspar-vertebrates.json", "url": "https://jaspar.elixir.no/api/v1/matrix/?collection=CORE&tax_group=vertebrates&version=latest&page_size=1000&format=json", "retrieved_on": "2026-10-19", "sha256": "5907835c6a6af2dc8f2e7184a074c206a1ad0ab9a9c2c828edc301a9ee07d1d5", "bytes": 223543, "snapshot": "source-snapshots/jaspar-vertebrates.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "jaspar-vertebrates-page2.json", "url": "https://jaspar.elixir.no/api/v1/matrix/?collection=CORE&format=json&page=2&page_size=1000&tax_group=vertebrates&version=latest", "retrieved_on": "2026-10-19", "sha256": "814fa40caa9544ab5fb5ba3e89d174811fdd85eef44ebcd13ae20bb88a550f1a", "bytes": 4421, "snapshot": "source-snapshots/jaspar-vertebrates-page2.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "encode-oxtr.json", "url": "https://api.genome.ucsc.edu/getData/track?genome=hg38;track=encRegTfbsClustered;chrom=chr3;start=8740380;end=8779628", "retrieved_on": "2026-10-19", "sha256": "00bd2292321d6dbb1f77e2a54275b7ab19970365536e5cd5be154e4c9ecd679f", "bytes": 47543, "snapshot": "source-snapshots/encode-oxtr.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "encode-inputs.txt.gz", "url": "https://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/encRegTfbsClusteredInputs.txt.gz", "retrieved_on": "2026-10-19", "sha256": "61409875e6ca7586829ee5418a70b093975ff0e5e209dd909c8b803ce0c9f9ba", "bytes": 32053, "snapshot": "source-snapshots/encode-inputs.txt.gz.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "encode-sources.txt.gz", "url": "https://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/encRegTfbsClusteredSources.txt.gz", "retrieved_on": "2026-10-19", "sha256": "7dcae9e1727f0eeefdd8dc2948f9b670f496a7b2c8ddbe013267da55dd6a5ab3", "bytes": 22234, "snapshot": "source-snapshots/encode-sources.txt.gz.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "oreganno-oxtr.json", "url": "https://api.genome.ucsc.edu/getData/track?genome=hg38;track=oreganno;chrom=chr3;start=8740380;end=8779628", "retrieved_on": "2026-10-19", "sha256": "df69943993dff1a2056e836a6a592d586ac0dcc1002ca9c9ec0a0fe9200b7edb", "bytes": 5322, "snapshot": "source-snapshots/oreganno-oxtr.json.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "jaspar-docs.html", "url": "https://jaspar.elixir.no/docs/", "retrieved_on": "2026-10-19", "sha256": "0b938e89c6a753e018b7c5d9c03ccd0361d5d93e85078b3e7dd38ceea6c3786d", "bytes": 61455, "snapshot": "source-snapshots/jaspar-docs.html.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "jaspar-track-doc.html", "url": "https://raw.githubusercontent.com/ucscGenomeBrowser/kent/master/src/hg/makeDb/trackDb/jaspar.html", "retrieved_on": "2026-10-19", "sha256": "dcacb9a1df8b976b36d09f447e369ceb1592a77bc9b5f673f77f03612b11ab65", "bytes": 17673, "snapshot": "source-snapshots/jaspar-track-doc.html.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "encode-track-doc.html", "url": "https://raw.githubusercontent.com/ucscGenomeBrowser/kent/master/src/hg/makeDb/trackDb/human/encRegTfbsClustered.html", "retrieved_on": "2026-10-19", "sha256": "be7aced0fc9fae8e97a99c9fdec7250cce5021e95ab887a7d45480906e27694b", "bytes": 8481, "snapshot": "source-snapshots/encode-track-doc.html.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." }, { "file": "oreganno-doc.html", "url": "https://raw.githubusercontent.com/ucscGenomeBrowser/kent/master/src/hg/makeDb/trackDb/oreganno.html", "retrieved_on": "2026-10-19", "sha256": "399634ae60cf7abe30ad9ba27c2b95276be4b8eee9d32b34aace645c354cfead", "bytes": 5600, "snapshot": "source-snapshots/oreganno-doc.html.gz", "reuse_note": "Public JASPAR data / UCSC distributed genome tracks and track documentation; retain source attribution. No TRANSFAC licensed data included." } ], "notion": { "page_url": "https://www.notion.so/3fd7b9c99c5681239265feb88ed38d68", "database_id": "e9e8e3a4-8393-4ff6-9997-b7fac92396ff", "data_source_id": "61858aac-dfd5-4a63-a090-2ba3b62b769f" }, "harmonisation": { "version": "oxtr-human-sites-2026-10-19-v1", "summary": { "total_observations": 218320, "literature_records": 45, "human_literature_records": 28, "distinct_reference_intervals": 87815, "colocated_interval_groups": 34819, "retained_observations": 218320, "discarded_observations": 0, "mapped_human_literature_records": 3, "exact_published_sequence_mappings": 2, "literature_database_overlap_pairs": 5118, "human_evidence_categories": { "annotation_prediction": 8, "laboratory_tested": 20, "binding_evidence": 12, "functional_evidence": 9, "regulatory_context": 5 }, "unique_confirmed_human_site_total": null }, "categories": [ { "id": "laboratory_tested", "label": "Laboratory tested", "definition": "The record reports a laboratory assay. Includes positive, mixed and negative results; a group-level test does not resolve every member." }, { "id": "binding_evidence", "label": "Binding evidence", "definition": "Reported DNA binding or regional occupancy, at the resolution and in the system stated by the source." }, { "id": "functional_evidence", "label": "Functional evidence", "definition": "An element, region or element-based reporter has an experimental regulatory response. This does not imply every nucleotide or predicted motif was independently validated." }, { "id": "annotation_prediction", "label": "Annotation or prediction", "definition": "Sequence or database annotation; direct binding is not established by the annotation alone." }, { "id": "regulatory_context", "label": "Regulatory context", "definition": "Evidence concerning gene regulation without an independently resolved binding site in this record." } ], "project": "human-site-project.json", "observations": "normalized-observations.json.gz", "intervals": "reference-intervals.json.gz", "overlaps": "literature-overlaps.json", "literature": "normalized-literature.json", "bed": "mapped-literature.bed" }, "coordinate_experiment": { "version": "oxtr-coordinate-experiment-2026-10-20-v1", "manifest": "experiment-v1/manifest.json", "methods": "experiment-v1/methods.md", "shared_graph_rules": "experiment-v1/overlay-v1.json", "shared_graph_rules_csv": "experiment-v1/overlay-v1-fields.csv", "overlay_version": "oxtr-comparison-geometry-2026-10-21-v3", "collections": [ "studies", "encode", "jaspar" ], "views": [ "line", "circle", "m9" ], "atlas_sequences": [ "alpha", "beta", "gamma", "epsilon" ], "counts": { "studies": 128, "encode": 255, "jaspar_score_400": 9164 }, "status": "Exploratory coordinate mapping with Python, Biopython and Wolfram checks; biological association untested" }, "binding_interpretation": { "version": "oxtr-binding-outcomes-2026-10-21-v2", "reviewed_on": "2026-10-21", "scope": "Source-supported interpretation of the current mapped observations; source coordinates and measurements are unchanged.", "priority": [ { "label": "Binding detected at a defined sequence", "description": "A positive binding result at a specified DNA sequence is the most direct anchor for a location comparison. Check the protein, assay and biological context." }, { "label": "Protein association detected across a region", "description": "ENCODE and BrainTF supply experimental support over a stretch of DNA. Resolve the site within it and inspect the contributing cell types and experiments." }, { "label": "Sequence match predicted", "description": "JASPAR matches are candidates for exploration and experimental follow-up. A model match alone does not establish binding at that location." } ], "priority_note": "This is an Atlas research-priority guide, not a platform trust score. A published paper can contain any evidence type. Relevant context, assay quality and replication matter. Binding and effects on gene activity are separate outcomes.", "geometry_note": "Biological support does not establish statistical significance or predictive value for an Atlas geometric match. That requires a defined comparison and appropriate controls.", "negative_controls": "No negative binding controls have been curated for this coordinate experiment. An absent record or an unclassified outcome is not a negative experiment.", "outcome_vocabulary": { "binding_detected": "Positive binding result reported for the named DNA element under the stated assay conditions.", "regional_association_detected": "Positive regional protein-association signal; direct sequence-specific binding and an exact motif are not established by this cluster alone.", "binding_not_detected": "No binding detected under specified assay conditions; assign only from an explicit source result.", "mixed_or_unclear": "Results differ or are inconclusive; retain each assay and condition.", "prediction_only": "The record reports a computational match; no location-specific binding result is established by this record.", "not_classified": "Outcome not classified in this layer; not equivalent to untested or negative." }, "defaults": { "studies": { "status": "not_classified", "label": "Binding outcome not yet classified", "resolution": "unresolved", "result": "The outcome has not been classified in this interpretation layer; consult the original finding.", "assay": "See source record", "context": "See source record", "expression_effect": "Not assessed in this interpretation layer", "review_depth": "No outcome classification assigned", "source_url": null }, "oreganno": { "status": "not_classified", "label": "Binding outcome not yet classified", "resolution": "unresolved", "result": "The outcome has not been classified in this interpretation layer; consult the original finding.", "assay": "See source record", "context": "See source record", "expression_effect": "Not assessed in this interpretation layer", "review_depth": "No outcome classification assigned", "source_url": null }, "encode": { "status": "regional_association_detected", "label": "Regional association detected", "resolution": "region", "result": "A ChIP-seq peak cluster records protein association with this DNA region. Binding can be direct or mediated by other proteins; the plotted centre is not an identified binding site.", "assay": "ChIP-seq peak clusters", "context": "Contributing experiments and cell types are retained in the record.", "expression_effect": "Effect on OXTR expression not established by this cluster", "review_depth": "UCSC ENCODE 3 track methods and archived cluster provenance; individual raw experiments not reanalysed", "source_url": "https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg38&g=encRegTfbsClustered" }, "jaspar": { "status": "prediction_only", "label": "Prediction only", "resolution": "motif_match", "result": "A DNA sequence matches a JASPAR motif model. This record does not establish binding at this location in a cell.", "assay": "Computational motif scan", "context": "Model-derived sequence match; no cell-specific occupancy measurement in this record.", "expression_effect": "Effect on OXTR expression not established by this prediction", "review_depth": "JASPAR documentation and archived UCSC prediction", "source_url": "https://jaspar.elixir.no/docs/" }, "braintf": { "status": "regional_association_detected", "label": "Regional association detected", "resolution": "region", "result": "A screened BrainTF ChIP-seq peak records protein association across this region; an exact binding sequence is unresolved.", "assay": "ChIP-seq peak calls", "context": "Human postmortem brain; the context is retained on each observation.", "expression_effect": "Effect on native OXTR expression not established by this occupancy measurement.", "review_depth": "Public processed peaks, author replication tests, FRiP and HOT annotations reviewed; raw reads not reanalysed.", "source_url": "https://doi.org/10.1038/s41593-024-01658-8" } }, "records": { "TFBS012": { "status": "binding_detected", "label": "Binding detected", "resolution": "reported_sequence", "result": "US-1 showed protein binding in the reported DNA-binding assays. The specific binding protein remains unresolved.", "assay": "Differential electrophoretic mobility shift assay (EMSA)", "context": "Nuclear extracts from human term-pregnant and non-pregnant myometrium (uterine muscle).", "expression_effect": "Enhancer activity reported in an artificial reporter construct in cultured SKN cells; not a direct measurement of the element’s effect at its native OXTR locus.", "review_depth": "Published abstract reviewed; full-text methods and controls not independently reassessed", "source_url": "https://pubmed.ncbi.nlm.nih.gov/10221779/" }, "TFBS013": { "status": "binding_detected", "label": "Binding detected", "resolution": "reported_sequence", "result": "US-2 showed specific binding by human MafF in the reported experiments.", "assay": "Yeast one-hybrid screening followed by EMSA", "context": "Human term-myometrium cDNA library and follow-up protein–DNA binding assays.", "expression_effect": "A role in OXTR upregulation was proposed; a causal effect on native OXTR expression is not established by the reviewed abstract.", "review_depth": "Published abstract reviewed; full-text methods and controls not independently reassessed", "source_url": "https://pubmed.ncbi.nlm.nih.gov/10527846/" }, "TFBS044": { "status": "regional_association_detected", "label": "Regional association detected", "resolution": "region", "result": "A screened BrainTF ChIP-seq peak records protein association across this region; an exact binding sequence is unresolved.", "assay": "ChIP-seq peak calls", "context": "Human postmortem brain; the context is retained on each observation.", "expression_effect": "Effect on native OXTR expression not established by this occupancy measurement.", "review_depth": "Public processed peaks, author replication tests, FRiP and HOT annotations reviewed; raw reads not reanalysed.", "source_url": "https://doi.org/10.1038/s41593-024-01658-8" }, "TFBS045": { "status": "not_classified", "label": "Functional reporter evidence; binding unresolved", "resolution": "unresolved", "result": "The outcome has not been classified in this interpretation layer; consult the original finding.", "assay": "See source record", "context": "See source record", "expression_effect": "Human OCE7 DNA enhanced reporter activity in mouse cells and drove mouse olfactory-bulb reporter activity. Native human OXTR regulation remains unresolved.", "review_depth": "No outcome classification assigned", "source_url": "https://doi.org/10.1093/hmg/ddaf022" } } }, "study_additions": { "version": "oxtr-study-additions-2026-10-21-v1", "reviewed_on": "2026-10-21", "window": { "assembly": "GRCh38", "chromosome": "chr3", "start_0based": 8740380, "end_exclusive": 8779628 }, "braintf": { "records": 126, "targets": 43, "contexts": 13, "promoter_records": 114, "selection": "One matching QC row; author replication test passes; both reported FRiP values at least 1%; overlapping author union regions labelled NOT-HOT; no identified target-label conflict.", "FRiP_interpretation": "The 1% cutoff is an explicit Atlas review filter, not a universal quality threshold or the authors’ replication-pass definition.", "HOT_interpretation": "Uses the authors’ union-region annotation; high-occupancy, conflicting and unassessed classifications are excluded.", "count_unit": "Peak observations across assay contexts, not unique sites or independent donors.", "coordinate_conversion": "Author GRanges starts were converted from 1-based to 0-based by subtracting one; exclusive ends equal the converted start plus GRanges width.", "donor_limit": "The experiments share four postmortem donors across regions. Repeated contexts do not establish population replication.", "assay_limit": "Assayed targets include chromatin-associated proteins and cofactors as well as transcription factors. ChIP-seq measures regional occupancy; it does not locate a contact nucleotide.", "contextual_annotations": "Overlaps with existing ENCODE and PsychSCREEN brain candidate regulatory regions are spatial context, not independent validation of OXTR regulation.", "review_scope": "13 author-packaged peak datasets and 226 additional public portal peak files inspected. The browser retains the conservative subset; all 390 locus observations, including histone marks, remain in the review download.", "excluded_result": "No nominal allele-specific result in the separately reviewed BrainTF table passed BH-adjusted P < 0.05 at this locus; none is presented as confirmed allele-specific binding.", "sources": [ "https://doi.org/10.1038/s41593-024-01658-8", "https://github.com/aanderson54/Loupe_BrainTF", "https://chip-portal.hudsonalpha.org/" ] }, "enhancer": { "pmid": "39957428", "doi": "10.1093/hmg/ddaf022", "result": "OCE1, OCE5 and OCE7 enhanced reporter activity in mouse hypothalamic cells. The tested DNA was human. OCE7 also drove reporter activity in mouse olfactory bulb at P28 and P56; adult hypothalamic activity was not detected.", "atlas_scope": "OCE2, OCE6 and OCE7 reported regions intersect the current window. OCE2 and OCE6 were negative in the reporter assay. The window is unchanged.", "boundary": "Reporter activity does not establish a named transcription-factor binding site or causal regulation of native human OXTR.", "coordinates": "The reported OCE7 candidate interval and the Table 1 luciferase-primer span differ. Reported intervals and primer matches are retained separately, without a precise binding-site overlay.", "source": "https://pmc.ncbi.nlm.nih.gov/articles/PMC12056307/" }, "geometry_scope": "The Studies comparison and data browser both include 128 observations: US-1, US-2 and 126 screened BrainTF occupancy regions. Region centres are plotting representatives, not precise binding sites. The enhancer paper remains functional literature evidence.", "files": { "peaks": "study-additions-v1/braintf-peaks.json", "peak_csv": "study-additions-v1/braintf-peaks.csv", "review": "study-additions-v1/braintf-locus-review.json", "enhancers": "study-additions-v1/enhancer-regions.json" } } }, "coordinate_experiment": { "version": "oxtr-coordinate-experiment-2026-10-20-v1", "status": "Exploratory coordinate comparison; biological association untested", "reference": { "species": "Homo sapiens", "assembly": "GRCh38 / hg38", "chromosome": "chr3", "start_0based": 8740380, "end_exclusive": 8779628, "length_bp": 39248, "gene_id": "ENSG00000180914", "canonical_transcript": "ENST00000316793.8", "gene_start_1based": 8750381, "gene_end_1based": 8769628, "gene_strand": -1, "selection": "Ensembl OXTR gene body plus 10,000 bases on each genomic side", "scope": "A defined locus window; distal regulatory elements outside it are not captured. Overlapping records may extend beyond its boundaries.", "origin_genomic_base_0based": 8779627, "direction": "OXTR minus strand; descending genomic coordinates", "clockwise_from": "north", "coordinate_convention": "0-based, end-exclusive" }, "mapping": { "interval": "Use the interval intersection with the fixed reference window; retain the original interval", "anchor": "Central base of visible interval; for even widths choose the first central base in OXTR direction", "formula": "d0=window_end-min(end,window_end); d1=window_end-max(start,window_start); d=floor((d0+d1-1)/2)", "full_circle": "turns=d/window_length; x=sin(2*pi*turns), y=-cos(2*pi*turns)", "modulo9": "r=d mod 9; display 0 as 9; x=sin(2*pi*r/9), y=-cos(2*pi*r/9)", "origin_note": "This window-edge origin is a fixed plotting convention, not the OXTR transcription start site", "inference": "No rotation optimisation, fit statistic, p-value, enrichment test or biological validation" }, "jaspar_minimum_score": 400, "summaries": { "studies": { "count": 128, "unit": "observations", "residue_counts_0_to_8": [ 14, 20, 14, 24, 11, 14, 8, 8, 15 ], "clipped_intervals": 0, "anchor_offset_sum": 1258775 }, "encode": { "count": 255, "unit": "regions", "residue_counts_0_to_8": [ 30, 39, 22, 30, 29, 29, 31, 22, 23 ], "clipped_intervals": 21, "anchor_offset_sum": 5213866 }, "jaspar": { "count": 9164, "unit": "matches", "residue_counts_0_to_8": [ 1022, 926, 1033, 909, 1085, 1089, 945, 1058, 1097 ], "clipped_intervals": 1, "anchor_offset_sum": 181966938 } }, "files": { "studies": { "file": "studies.json", "sha256": "73b83ada4f22caf94c4d039490594d1bd8a84b4c2c41e9801df76261943490d3" }, "encode": { "file": "encode.json", "sha256": "1fdae9dae759f3a7f9045a3332d5998fb8b9034b5cab040a4ac5dbbe03376c5d" }, "jaspar": { "file": "jaspar.json.gz", "sha256": "a00bef58682099f3f6b0ca1a7cdb834354cc30d8fa14baef89572195fd6b20c9" } }, "atlas": { "id": "fibonacci-m9-p24", "sha256": "55da8b5e3406368cece4476720ca9d9208627e30a827fca30533d3235d74d8ff", "alpha": { "residues": [ 0, 1, 1, 2, 3, 5, 8, 4, 3, 7, 1, 8, 0, 8, 8, 7, 6, 4, 1, 5, 6, 2, 8, 1 ], "display_values": [ 9, 1, 1, 2, 3, 5, 8, 4, 3, 7, 1, 8, 9, 8, 8, 7, 6, 4, 1, 5, 6, 2, 8, 1 ] }, "beta": { "interval_sums": [ 4, 17, 16, 23, 10, 11 ], "interval_residues": [ 4, 8, 7, 5, 1, 2 ], "display_cycle": [ 4, 8, 7, 5, 1, 2 ], "intervals": [ { "from_index": 0, "to_index": 4, "interior_indices": [ 1, 2, 3 ], "interior_values": [ 1, 1, 2 ], "sum": 4, "residue": 4 }, { "from_index": 4, "to_index": 8, "interior_indices": [ 5, 6, 7 ], "interior_values": [ 5, 8, 4 ], "sum": 17, "residue": 8 }, { "from_index": 8, "to_index": 12, "interior_indices": [ 9, 10, 11 ], "interior_values": [ 7, 1, 8 ], "sum": 16, "residue": 7 }, { "from_index": 12, "to_index": 16, "interior_indices": [ 13, 14, 15 ], "interior_values": [ 8, 8, 7 ], "sum": 23, "residue": 5 }, { "from_index": 16, "to_index": 20, "interior_indices": [ 17, 18, 19 ], "interior_values": [ 4, 1, 5 ], "sum": 10, "residue": 1 }, { "from_index": 20, "to_index": 0, "interior_indices": [ 21, 22, 23 ], "interior_values": [ 2, 8, 1 ], "sum": 11, "residue": 2 } ], "minimal_cycle": [ 4, 8, 7, 5, 1, 2 ], "native_doubling": true, "recognised_doubling_cycle": [ 1, 2, 4, 8, 7, 5 ], "rotation_to_recognised": 4, "m9_doubling_cycle_present": true, "start_value": 4, "start_interval_clock_positions": [ 24, 4 ], "start_interval_values": [ 1, 1, 2 ], "circle_positions": 9, "cycle_length": 6, "endpoint_rule": "Exclude endpoints, include wraparound; raw residues used for sums. Empty interiors sum to zero." }, "gamma": { "alpha_indices": [ 0, 4, 8, 12, 16, 20 ], "clock_positions": [ 24, 4, 8, 12, 16, 20 ], "clockwise_values": [ 9, 3, 3, 9, 6, 6 ], "triangle_paths": [ [ 0, 8, 16, 0 ], [ 4, 12, 20, 4 ] ] }, "epsilon": { "alpha_indices": [ 0, 8, 20, 12, 4, 16, 0 ], "traversal_values": [ 9, 3, 6, 9, 3, 6, 9 ], "three_step_repeat": true, "formation_id": "6-nodes-offset-0", "clock_positions": [ 24, 8, 20, 12, 4, 16, 24 ], "rotation_degrees": 0.0, "status": "Proposed geometric traversal; physical interpretation not assessed." }, "orientation": "clockwise from north", "grids": "Alpha/Gamma/Epsilon: 24 period positions; Beta: 9 residue positions" }, "source_sha256": { "catalogue.json": "60f66a0be6bcf3b94891aa6d71ac9c5012c6040bfa39e4cf48fb85127c1cf400", "study-additions-v1/braintf-peaks.json": "2135e0f2198bba5b0a2d2a3c60ba425d52e212dae6978f3d613b638b585777a9", "reference-dna.json": "b505a95d97ed1db084e0dbe07f6cb2e9123d833e62ada29deb5d6bc11c6e5b9f", "reference-dna.fa": "d90a9e83bd3f010dcea2ae7966bbc664ae967f0766c5359fbd7f4bafc3c11509", "sequence-mapping.json": "4b8fc2b250685af248eacd1525c83d44f8ca96ae822f8849637cfdbcb524cbfb", "encode-clusters.json": "7a111b4d6e937ae5fbfadf5cba1ffc9dba968402aa04b2587b120a4fc6c3c198", "encode-provenance.json": "678cfe3531ebd57236be2aa43cc60f24c116b129b3e4ebf93b57e604144a120a", "jaspar-predictions.json.gz": "ef1e2bf01dfcddab0e7096fae52c20a1e9ed06d4517ca21467377e8a2fa46832", "jaspar2026-vertebrates.jaspar": "4005b5449ba07d9b58495f51143186e7e3959efd0ad670770fbddf57bf941e8f" }, "verification_files": [ "python-validation.json", "wolfram-validation.json", "verify.wl" ], "reproducibility_files": [ "build_experiment.py", "requirements.txt", "methods.md" ] } } ``` ## Sources - [science.js](https://universalmind.tv/informatics/science.js) · SHA-256: 3844b867a860e26cb0bc3113470759d4c49eee886f2d6591376dbf78516b3945 · Exact file bytes - [tfbs-geometry.js](https://universalmind.tv/informatics/tfbs-geometry.js) · SHA-256: 8ee3b7eb0dc5f7c60c44c5b01bed9f7b49371b1f34b5a512eae7dda082161e5d · Exact file bytes - [pilot-v1/oxtr-tfbs-v1/catalogue.json](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/catalogue.json) · SHA-256: 60f66a0be6bcf3b94891aa6d71ac9c5012c6040bfa39e4cf48fb85127c1cf400 · Exact file bytes - [pilot-v1/oxtr-tfbs-v1/experiment-v1/manifest.json](https://universalmind.tv/informatics/pilot-v1/oxtr-tfbs-v1/experiment-v1/manifest.json) · SHA-256: 48671fb3fb93f99da4d9551f94d2625b00a6f68660542c335153b4d8e7c16c3b · Exact file bytes